Enjoy the best grades that will raise your GPA.

Category: Java (Page 1 of 2)

DO NoT USE CHEGG PLEASE Math Tool As a software developer, you have received

DO NoT USE CHEGG PLEASE
Math Tool
As a software developer, you have received a new requirement from an Elementary School to develop a software to help kids to learn about whole number concepts, such as odd numbers, even numbers, find the greatest number and compute the average.
The Elementary School wants you to build a program that prompts the user to enter his/her
name (Student name) and to enter a series of whole numbers.
Thus, your program will receive the following information:
• Student name
• Whole numbers entered at the keyboard.
Note: The Student will enter 99 to finish entries and exit the program.
The program then outputs the following information:
• Student name
• A count of how many numbers were entered
• A count of how many even numbers were entered
• A count of how many odd numbers were entered.
• The sum of the numbers entered.
• The average of the numbers entered.
• The sum of the odd numbers entered.
• The average of the odd numbers.
• The sum of the even numbers entered.
• The average of the even numbers entered.
• The largest odd number entered.
• The largest even number entered.
Please refer to the Sample Output file for full details of what the program should look like when
it runs.

Download the worksheet and save it as Mod3-Worksheet-Programming-Last-First.docx

Download the worksheet and save it as Mod3-Worksheet-Programming-Last-First.docx. For example, Mod3-Worksheet-Programming-Smith-John.docx.
Consider the problem, design an algorithm (or algorithms) that would solve the problem, and then implement the algorithm in Java.
Create a new folder and name it as Mod3-Java-Programming-Last-First, for example, Mod3-Java-Programming-Smith-John.
Write the source code for each problem and save them as .java files in the folder you created. There are five programming problems for this module so you should have five .java files. Name your java files as Mod3-Problem#.java, for example, Mod3-Problem1.java.
Please insert the algorithm written in pseudocode as a comment in the beginning of your program.
Take screenshots of your running program – you can take screenshots using PrintScreen or any tool that you are familiar with, making sure that the console window in which you run the program appears on the screen.
Copy the screenshots in the worksheet. If your program has different outcomes, take screenshots of each variation.

Instructions: Solve the following problems and then submit the source code (.jav

Instructions: Solve the following problems and then submit the source code (.java files) for each.
1) Write a program that asks the user for a DNA sequence file in FASTA format (see below), the program should test to make sure the file exists on the computer first. And if it
does, the program should proceed to calculate the DNA composition of the sequence (i.e.
number and percentage of each bp: A, G, T and C). Print out the results to the screen, along with
the total length of the DNA sequence.
2) Write a program that asks the user for a DNA sequence file in FASTA format (you can use
the same one as above). And then prints out to a file the compliment of that sequence, in FASTA
format, i.e. replace A with T, T with A, G with C and C with G.
FAsta file below:
>G75608.1 STSGM003052 genomic soybean DNA Glycine max STS genomic, sequence tagged site
GGATAATTGGTTTTACGAAAATGCAACTAATATAAAATCTATAATTGATTATTATTATTATTATTATTAT
TATTATTATTTTGATAATAAATTTTATTTTAAAGTAAAATTAAAAAAAACTCAAAAATGTATCACAACAA
ATTAAAATTTATCACTTTAAAATTAAAAAAAATGCTATAAACGTTTTTTTAGGTGATTAGG

The evolution of Internet of things (IoT) has introduced innovative solutions fo

The evolution of Internet of things (IoT) has introduced innovative solutions for smart energy management of household prosumers during the recent years. In order to demonstrate the practical use of IoT for smart energy management in a small-scale practical setting, the aim of this project is to implement a mobile-based application for smart energy management of home appliances. Specifically, the project aims to design a mobile-based application which allows the users of a household to first connect to a remote database on the cloud server to access the real-time electricity price during any time period of a day. User should be then able to insert the name of appliance (such as water boiler, iron, washing machine, …) and as the response, the application should provide an optimal time interval for the user such that using the appliance during that time interval will result in the maximum revenue for the user based on the real-time price. As another feature of the application, the user can set a desired pricing model (such as RTP, ToU) and the optimal time interval for the use of appliance is determined by performing a linear search over a flexible interval initially given by the user and then computing the revenue using a simple integral over the pricing model. The related recommendations for the use of appliance during different time interval of the day are also given by the application.
Skills: Mobile programming, GUI programming, Basic knowledge of mathematics, optimization and power energy

This is an individual assignment which involves modifying the a3 compiler for th

This is an individual assignment which involves modifying the a3 compiler for the language PL0 to add value and reference parameters, and function results. I’d suggest adding value parameters first, then the reference parameters, and then the function results.
You need to submit the following list of individual files (not a .zip or any other form of archive file) for evaluation and marking. Note that file
names are case-sensitive. Only files below can be modified.
PL0.cup
ExpNode.java
ExpTransform.java
StatementNode.java
StatementTransform.java
StatementVisitor.java
StaticChecker.java
CodeGenerator.java

Install JDK and any IDE on your home computer. Net Beans is a free IDE or use JG

Install JDK and any IDE on your home computer.
Net Beans is a free IDE or use JGRASP, etc.
you must have header comments with
Your name.
The date.
Which class you are in.
The purpose of the file.
You only need to zip large numbers of files.
If you have 4 or more in a single program, please zip.
3 or less, please do not zip.
As always, source files only.
only submit unzipped source files (unless the number of files gets large). You can find NetBeans source files in your documents/NetBeansProjects/project name files. They will be in the src directory.

The APIs are divided up into 2 categories – an ‘input’ list API, and an ‘output’

The APIs are divided up into 2 categories – an ‘input’ list API, and an ‘output’ list API (note that you may need
to both send and receive information from either category, it is a thematic difference rather than a purely
technical one). You will be assigned 1 API from each category – in essence your application will take
information from one API and output it in some way through another.
You grade is initially determined by the completion level of the API. Each API will follow a similar scheme:

I’m working on a java discussion question and need an explanation and answer to help me learn

Learning Goal: I’m working on a java discussion question and need an explanation and answer to help me learn.PLEASE DONOT BID IF YOU DONT KNOW HOW TO DO THIS 100% CORRECT! I will request for a refund if its not!!! so make sure!PLEASE DO IT FROM SCRATCH OTHERWISE IF COPIED I WILL REQUEST FOR A REFUND!!!! IT GETS CHECKED!!!!instructions are attachedPLEASE READ INSTRUCTIONS CAREFULLY!!!!Note: You are not allowed to use any library or module that supports regular expressions. Examples of such libraries/modules are re of Python and regex of Java or C++.
Requirements: as instruction suggests   |   .doc file

Does it make sense to have decimals for these variables?

Learning Goal: I’m working on a java exercise and need guidance to help me learn.(1) Write a program that calculates the energy needed to heat water from an initial temperature to a final temperature. Your program should prompt the user to enter the amount of water in kilograms and the initial and final temperatures of the water. The formula to compute the energy is Q = M * (finalTemperature – initialTemperature) * 4184
where M is the weight of water in kilograms, initial and final temperatures are in Celsius, and energy is measured in joules. Here is a sample run:*Note: the values entered are shown under the prompt but are not actually part of the output of the program.Enter the amount of water in kilograms:
55.5
Enter the initial temperature:
3.5
Enter the final temperature:
10.5
The energy needed is 1625484.0
Use the code template below to answer the first question:
public class CalculateEnergy {
public static void main(String[] args) { java.util.Scanner scnr = new java.util.Scanner(System.in); System.out.print(“Enter the amount of water in kilograms: “); double m = /* FIX ME with scnr.nextDouble(); */ System.out.print(“Enter the initial temperature: “); double f = /* FIX ME too */ System.out.print(“Enter the final temperature: “); double i = /* FIX ME too */ System.out.println(“The energy needed is ” + /* FIX ME–do the math here */ ); }}2) Problem AJimmy and 4 of his friends are at the movies and he was asked to purchase the snacks. The prices are as follows:popcorn: $5.75
candy bar: $1
soda: $1.50
water: $1
Calculate the price of buying p bags of popcorn, c candy bars, s sodas, and w waters.They all agreed to split the price evenly, calculate the amount each person should pay.Problem BJane is planning to put a new fence around her flower garden. She wants to change the shape, but doesn’t want to change the amount of space it occupies. It is currently a square that has sides of length squareSide. She wants to make it a rectangle with one set of parallel sides twice the length of the other set of parallel sides. What should the length of the sides be?Data Type Hint: Can you purchase half a bag of popcorn/candy bar/soda/water? Does it make sense to have decimals for these variables? What about for the price or the length of a fence side?Printing floating point numbersStudents can spend hours trying to get output to match. Suppose the statementSystem.out.println(“Volume is ” + volume);`
outputs this value for volumeVolume is 56.43531235683212352099798
but the expected output in the grading program isVolume is 56.435312356832123520998
For grading, we introduce a new method printf(). The f stands for “format” and we can use it to limit the number of digits following the decimal point to enforce a lesser degree of precision and rounded output. The new statement looks like thisSystem.out.printf(“Volume is %8.5f”, volume);
or with a newlineSystem.out.printf(“Volume is %8.5fn”, volume);
Now the output isVolume is 56.43531
and the grading program–and the student–can be happy!Use the code template below to answer the second question please:public class WordProblems { public static void main(String[] args) { //ID comment goes here!!!!! /* Your variables go here! Including the Scanner*/ /*Solution to Problem A the numbers are read in the order of price listing (p,c,s,w)*/ System.out.println(“Price of the snack: $” + /*your variable(s) name*/); System.out.println(“Individual price: $” + /*your variable(s) here*/); /*Solution to Problem B Note: the squareroot function is Math.sqrt(variable) */ System.out.printf(“Length of long side: %6.5fn” + /*your variable here*/); System.out.printf(“Length of short side: %6.5fn” + /*your variable here*/); }}

« Older posts

© 2022 assignmetshive

Theme by Anders NorenUp ↑